Antibodies, polypeptides and uses thereof
a polypeptide and antibody technology, applied in the field of antibodies and polypeptides, can solve the problems of abnormal increase in the density of the vessel, severe limitation of the growth of tumors that fail to attract a blood supply, and deregulation of the growth of the blood vessel
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
example 1
Preparation of Antibodies
[0261] The cDNA constructs that were used were as described in Table 2:
TABLE 2Full length MR cDNAMR ectodomain-FcMR IgA + B-FcMR IgA-Fc
[0262]“Fc” refers to the Fc region of the pIG vector. It is human IgG constant domains hinge, CH1, CH2, within the ends of the vector (multiple cloning site and splice acceptor region included). The nucleotide sequence of the vector is:
(SEQ ID NO: 31)AAGCTTGATATCGAATTCTGCAGCCCGGGGGATCCGGAGGGAGGGTGTCTGCTGGAAGCAGGCTCAGCGCTCCTGCCTGGACGCATCCCGGCTATGCAGCCCCAGTCCAGGGCAGCAAGGCAGGCCCCGTCTGCCTCTTCACCCGGAGGCCTCTGCCCGCCCCACTCATGCTCAGGGAGAGGGTCTTCTGGCTTTTTCCCCAGGCTCTGGGCAGGCACAGGCTAGGTGCCCCTAACCCAGGCCCTGCACACAAAGGGGCAGGTGCTGGGCTCAGACCTGCCAAGAGCCATATCCGGGAGGACCCTGCCCCTGACCTAAGCCCACCCCAAAGGCCAAACTCTCCACTCCCTCAGCTCGGACACCTTCTCTCCTCCCAGATTCCAGTAACTCCCAATCTTCTCTCTGCAGAGCCCAAATCTTGTGACAAAACTCACACATGCCCACCGTGCCCAGGTAAGCCAGCCCAGGCCTCGCCCTCCAGCTCAAGGCGGGACAGGTGCCCTAGAGTAGCCTGCATCCAGGGACAGGCCCCAGCCGGGTGCTGACACGTCCACCTCCATCTCTTCCTCAGCACCTCAACT...
example 2
The Antibody MR7 and the MR Ectodomain (Extracellular Fragment of MR Residues 1-467) Inhibit Formation of Vessel Sprouts in the Aortic Ring Assay
Summary
[0294] The role of MR in angiogenesis was investigated using the rat aortic ring assay. Segments of rat aorta were embedded in Matrigel and treated with either antibody MR7 or purified MR ectodomain protein. The sprouting vessels were allowed to develop over five day before scoring by three independent observers. The averaged scores over 20-25 separate experiments are shown in FIGS. 6A and 6B. Inter-scorer reliability was assessed using the method of Landis and Koch. The weighted kappa values calculated were 0.96 for MR7 and 0.93 for MR ectodomain. These kappa values show that there was a high degree of consistency between independent scorers.
Methods
[0295] Aortas were harvested from 200 g-300 g rats (6-8 weeks old) and immediately placed in MCDB 131 media. Connective tissue was removed and aortas cut into 1 mm-1.5 mm rings. 48-...
example 3
The MR Ectodomain (Extracellular Fragment of MR Residues 1-467) Inhibits Formation of Vessel Sprouts In Vivo
[0304] The ability of the MR ectodomain to inhibit angiogenesis in vivo was tested using a sponge angiogenesis assay (Hori Y. et al (1996) “Differential effects of angiostatic steroids and dexamethasone on angiogenesis and cytokine levels in rat sponge implants”Br. J. Pharmacol. 118(7): 1584-1591) performed on female C57 black mice. All mice received a subcutaneous sterile polyether sponge (type 611-9) disc (15×5×5 mm) under the dorsal skin at day 0. Test reagents were injected through the skin directly into the sponges every second day for 21 days (100 μl injection volume). Groups of 2 mice received either PBS control; 10 ng / ml basic fibroblast growth factor (bFGF); or 10 ng / ml bFGF+100 μg / ml MR ectodomain. Animals were scarified on day 21 and sponge's were removed, fixed in 3.7% paraformaldeyde and paraffin embedded. 5 micron sections were stained with haematoxylin and eosi...
PUM
Property | Measurement | Unit |
---|---|---|
Volume | aaaaa | aaaaa |
Fraction | aaaaa | aaaaa |
Density | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap