Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Specific indel molecular marker primer for detecting rice osnramp5 gene and its application

A molecular marker, rice technology, applied in DNA/RNA fragmentation, application, plant genetic improvement, etc., can solve the problem of materials cannot be used quickly, and achieve the effect of alleviating cadmium pollution, high accuracy, and alleviating stress

Active Publication Date: 2021-07-23
HUNAN HYBRID RICE RES CENT +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the strict supervision of genetically modified rice in my country, these materials cannot be quickly used in production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific indel molecular marker primer for detecting rice osnramp5 gene and its application
  • Specific indel molecular marker primer for detecting rice osnramp5 gene and its application
  • Specific indel molecular marker primer for detecting rice osnramp5 gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] A specific InDel molecular marker primer for detecting cadmium accumulation traits of rice OsNRAMP5 gene, including forward primer F (named P5-C8F) and reverse primer R (named P5-C8R) shown in Table 1 below.

[0043] Table 1: Specific InDel molecular marker primers for breeding rice with low cadmium accumulation

[0044] name base sequence P5-C8F CAATCCAAGACCCGGCATGAT (as shown in SEQ ID NO.1) P5-C8R GCGCCGCATAGGATTAGTTGA (as shown in SEQ ID NO.2)

[0045] Through the variation analysis of the OsNRAMP5 gene coding region in the resequenced rice materials, we found that Luohong 3A and Luohong 4A had a large fragment deletion variation in the region containing the OsNRAMP5 gene, and the large fragment deletion variation corresponds to the 7th position of the reference genome Shuhui 498 Chromosome 8899016-9307728 bases (sequence length about 408kb), this large fragment deletion mutation contains the entire OsNRAMP5 gene (OsNRAMP5 position is 8...

Embodiment 2

[0059] The application of the specific InDel molecular marker primer of embodiment 1 in the selection and breeding of rice with low accumulation of cadmium comprises the following steps:

[0060] (1) Use Luohong 3A as the donor and 9311 rice as the recipient;

[0061] (2) hybridizing donor and acceptor materials to obtain hybrid F1 generation seeds, and selfing F1 generation seeds to obtain F2 generation seeds;

[0062] (3) In the F2 generation population, specific InDel molecular marker primers were used for detection. The detection method was the same as in Example 1, and the plants with homozygous OsNRAMP5 gene deletion were screened out in the F2 generation population, which were rice materials with low cadmium accumulation.

[0063] For the isolated progeny produced by selfing in step (3), the specific InDel molecular marker primers were used to detect, and the isolated individuals were measured for cadmium content in stems and leaves at the seedling stage. The results ar...

Embodiment 3

[0068] The application of the specific InDel molecular marker primer of embodiment 1 in the selection and breeding of rice with low accumulation of cadmium comprises the following steps:

[0069](1) Luohong 4A was used as the donor, and the non-cadmium low-accumulation rice variety Yuzhenxiang was used as the acceptor;

[0070] (2) crossing the donor and acceptor materials to obtain hybrid F1 generation seeds, and backcrossing the F1 generation seeds and acceptor materials to obtain BC1F1 generation seeds;

[0071] (3) Use specific InDel molecular marker primers to detect in the BC1F1 generation population. The detection method is the same as in Example 1. In the BC1F1 population, the plants with heterozygous OsNRAMP5 gene deletion are screened out and then further selfed to obtain the offspring population The specific InDel molecular marker primers were used for detection, and the plants with homozygous OsNRAMP5 gene deletion were screened out, which were rice materials with ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a specific InDel molecular marker primer for detecting rice OsNRAMP5 gene and its application in detecting cadmium accumulation traits of rice OsNRAMP5 gene, forward primer F: 5'‑CAATCCAAGACCCGGCATGAT‑3'; reverse primer R: 5'‑GCGCCGCATAGGATTAGTTGA‑3'. The specific InDel molecular marker and its detection application method can quickly, efficiently, accurately and conveniently identify whether there is OsNRAMP5 gene deletion in rice, and can determine whether the deletion type is homozygous or heterozygous. The invention also discloses the application of the specific InDel molecular marker in the breeding of rice with low cadmium accumulation, and the rice material with low cadmium accumulation can be bred within two generations at the fastest, which is simple and efficient, high in accuracy, short in cycle, and does not use artificial Transgenic means have effectively alleviated the current problem of cadmium pollution in rice.

Description

technical field [0001] The invention belongs to the field of crop genetic breeding and relates to a specific InDel molecular marker primer for detecting rice OsNRAMP5 gene and application thereof. Background technique [0002] Cadmium, a heavy metal element, is highly toxic to both plants and humans, with a half-life of several decades. Cadmium in soil and water mainly accumulates in the human body through the food chain, accumulates in the kidneys and continuously enriches in the human body. The "Itai-Itai disease" that occurred in Japan at the beginning of the 20th century was caused by the accumulation of cadmium in the human body. Due to the long half-life of cadmium, even a low level of long-term intake will cause irreversible damage to the human respiratory system and bones, so cadmium has been classified as a first-class carcinogen by the World Health Organization. [0003] As one of the most important food crops in my country, rice is affected by the non-essential ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11A01H1/04
CPCA01H1/04C12Q1/6895C12Q2600/13C12Q2600/156
Inventor 袁定阳吕启明朱仁山吴贤婷孙志忠唐丽黄志远何强
Owner HUNAN HYBRID RICE RES CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com