Primer-probe set for detecting herpesvirus cyprini II, kit and application
A carp herpes virus and detection primer technology, which is applied in the field of primer-probe group detection of carp herpes virus type II, can solve the problems of time-consuming and labor-intensive cell separation and electron microscope observation, high requirements for experimental conditions and equipment, and cumbersome detection technology operations. To achieve the effect of avoiding virus transmission, good detection effect and improving reliability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] A detection primer-probe set for carp herpesvirus type II, including 2 pairs of primers: CyHV-2-F3 and CyHV-2-B3, CyHV-2-FIP and CyHV-2-BIP and 1 labeled probe: CyHV -2-FITC-PROBE; the primer probe sequence is as follows:
[0049] CyHV-2-F3: 5'-GTTCATCAGAGGTGTCCGAC-3', (SEQ ID No.1);
[0050] CyHV-2-B3: 5'-GGTCTTGCCACTCATGATCC-3', (SEQ ID No.2);
[0051] CyHV-2-FIP:
[0052] 5'
[0053] - CGACATCCATGTCACCAGCAGATTTTGATGCTTTACTGGAGGTCGG-3', (SEQ ID No. 3);
[0054] CyHV-2-BIP:
[0055] 5'
[0056] - AAGTCACACGCTTTCCAGACGGTTTTGAAGCTGTTGAGCAGAATG C-3', (SEQ ID No. 4);
[0057] CyHV-2-FITC-PROBE: 5'-TGATGATTATCAGCACGACC-3', (SEQ ID No.5);
[0058] Among them, CyHV-2-FIP is the 5' end biotin-labeled primer; CyHV-2-FITC-PROBE is the 5' end FITC-labeled probe.
[0059] A detection kit based on the above-mentioned primer probe set, further comprising 10× reaction buffer, Bst DNA polymerase, detection test strip buffer, positive DNA quality control product and nucleic aci...
Embodiment 2
[0062] Extraction of DNA:
[0063] Take 25 mg crucian carp liver, spleen, kidney, and brain tissues to be tested, a total of 4 samples, and use the total DNA extraction kit (QIAampDNA Mini Kit) to extract the total DNA of the sample as a positive template. A negative control (normal virus-free crucian carp) was set at the same time.
[0064] Loop-mediated isothermal (LAMP) amplification:
[0065] (1) According to the number of samples to be tested (groups 1 to 4), positive (group 5) and negative (group 6) are 1 each, so prepare 6 copies of 10× reaction buffer and add 8U of Bst DNA to polymerize Enzyme (large fragment), 80 μM CyHV-2-F3 and 80 μM CyHV-2-B3, 480 μM CyHV-2-FIP and 480 μM CyHV-2-BIP, 0.5 μM CyHV-2-FITC-PROBE, the volume of the pre-reaction solution was 21μL / tube, and label respectively;
[0066] (2) Groups 1 to 4 respectively pipette 4 μL of different concentrations of sample DNA to be tested and add them to nucleic acid detection reaction tubes, mix well; add p...
Embodiment 3
[0077] In order to study the effect of amplification time on the loop-mediated isothermal amplification, virus-positive samples were taken and processed according to the loop-mediated isothermal (LAMP) amplification steps in Example 1. Amplify for 15, 30, 45, and 60 minutes, and then carry out gradient gel electrophoresis for each amplification product, among which, M: DL1000DNA Marker; lane 1: 15min amplification product; lane 2: 30min amplification product; lane 3: 45min Amplified product; Lane 4: 60min amplified product.
[0078] The results show that the gel electrophoresis effect of 45-60min amplification products is clearer, and the 60min amplification time is the best (see figure 2 ).
PUM
Property | Measurement | Unit |
---|---|---|
Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap