Primer-probe set for detecting herpesvirus cyprini II, kit and application

A carp herpes virus and detection primer technology, which is applied in the field of primer-probe group detection of carp herpes virus type II, can solve the problems of time-consuming and labor-intensive cell separation and electron microscope observation, high requirements for experimental conditions and equipment, and cumbersome detection technology operations. To achieve the effect of avoiding virus transmission, good detection effect and improving reliability

Active Publication Date: 2020-03-20
ZHEJIANG INST OF FRESH WATER FISHERIES
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional cell separation and electron microscope observation are time-consuming and laborious. Molecular biology detection methods are widely used methods and are also the most sensitive methods. At present, the existing molecular biology methods for CyHV-2 mainly include ordinary PCR,

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer-probe set for detecting herpesvirus cyprini II, kit and application
  • Primer-probe set for detecting herpesvirus cyprini II, kit and application
  • Primer-probe set for detecting herpesvirus cyprini II, kit and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] A detection primer-probe set for carp herpesvirus type II, including 2 pairs of primers: CyHV-2-F3 and CyHV-2-B3, CyHV-2-FIP and CyHV-2-BIP and 1 labeled probe: CyHV -2-FITC-PROBE; the primer probe sequence is as follows:

[0049] CyHV-2-F3: 5'-GTTCATCAGAGGTGTCCGAC-3', (SEQ ID No.1);

[0050] CyHV-2-B3: 5'-GGTCTTGCCACTCATGATCC-3', (SEQ ID No.2);

[0051] CyHV-2-FIP:

[0052] 5'

[0053] - CGACATCCATGTCACCAGCAGATTTTGATGCTTTACTGGAGGTCGG-3', (SEQ ID No. 3);

[0054] CyHV-2-BIP:

[0055] 5'

[0056] - AAGTCACACGCTTTCCAGACGGTTTTGAAGCTGTTGAGCAGAATG C-3', (SEQ ID No. 4);

[0057] CyHV-2-FITC-PROBE: 5'-TGATGATTATCAGCACGACC-3', (SEQ ID No.5);

[0058] Among them, CyHV-2-FIP is the 5' end biotin-labeled primer; CyHV-2-FITC-PROBE is the 5' end FITC-labeled probe.

[0059] A detection kit based on the above-mentioned primer probe set, further comprising 10× reaction buffer, Bst DNA polymerase, detection test strip buffer, positive DNA quality control product and nucleic aci...

Embodiment 2

[0062] Extraction of DNA:

[0063] Take 25 mg crucian carp liver, spleen, kidney, and brain tissues to be tested, a total of 4 samples, and use the total DNA extraction kit (QIAampDNA Mini Kit) to extract the total DNA of the sample as a positive template. A negative control (normal virus-free crucian carp) was set at the same time.

[0064] Loop-mediated isothermal (LAMP) amplification:

[0065] (1) According to the number of samples to be tested (groups 1 to 4), positive (group 5) and negative (group 6) are 1 each, so prepare 6 copies of 10× reaction buffer and add 8U of Bst DNA to polymerize Enzyme (large fragment), 80 μM CyHV-2-F3 and 80 μM CyHV-2-B3, 480 μM CyHV-2-FIP and 480 μM CyHV-2-BIP, 0.5 μM CyHV-2-FITC-PROBE, the volume of the pre-reaction solution was 21μL / tube, and label respectively;

[0066] (2) Groups 1 to 4 respectively pipette 4 μL of different concentrations of sample DNA to be tested and add them to nucleic acid detection reaction tubes, mix well; add p...

Embodiment 3

[0077] In order to study the effect of amplification time on the loop-mediated isothermal amplification, virus-positive samples were taken and processed according to the loop-mediated isothermal (LAMP) amplification steps in Example 1. Amplify for 15, 30, 45, and 60 minutes, and then carry out gradient gel electrophoresis for each amplification product, among which, M: DL1000DNA Marker; lane 1: 15min amplification product; lane 2: 30min amplification product; lane 3: 45min Amplified product; Lane 4: 60min amplified product.

[0078] The results show that the gel electrophoresis effect of 45-60min amplification products is clearer, and the 60min amplification time is the best (see figure 2 ).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to view more

Abstract

The invention discloses a primer-probe set for detecting herpesvirus cyprini II, a kit and an application and belongs to the technical field of virus detection. The invention particularly relates to two pairs of primers for detecting the herpesvirus cyprini II, a marking probe, the kit based on the detecting primer-probe set and an non-diagnostic target application. According to the primer-probe set, the kit and the application, loop-mediated isothermal amplification and nucleic acid transverse side flow detection are combined, a detection process has no need of expensive instrument and equipment, and the reliability of detection is improved. Compared with the existing virus detection methods, on the basis of the same detection sensitivity, the primer-probe set and the kit have the characteristics of simplicity, convenience, rapidness and specificity, are safe to human and environments and can be applied to field use of technical personnel of production lines and culture operators. Theprimer-probe set and the kit can be applied to rapid detection on hematopoietic tissue necrosis of crucian carps, tracking detection on the herpesvirus cyprini II of crucian carps and cyprinus auratus and virus monitoring, viral transmission is avoided, and thus, the primer-probe set and the kit have popularization and application values.

Description

technical field [0001] The invention relates to the technical field of virus detection, in particular to a primer probe set, kit and application for detecting carp herpesvirus type II. Background technique [0002] Cyprinid herpes virus type II (Cyprinid herpes virus 2, CyHV-2), also known as goldfish (Carassius auratus) hematopoietic necrosis virus (goldfish haematopoietic necrosis virus, GFHNV), because the pathogen is the second herpes isolated from carps The virus, in accordance with the systematic nomenclature of the International Committee on Taxonomy of Viruses (ICTV), was officially named cyprin herpesvirus type II. CyHV-2 is a DNA virus, its nucleocapsid is hexagonal or spherical, with a diameter of 100-110nm, and the virion with envelope is oval, with a diameter of 175-200nm. CyHV-2 has extremely strong host specificity, and only infects goldfish, crucian carp and their common variants. It is highly pathogenic to goldfish and crucian carp, and the mortality rate c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11C12R1/93
CPCC12Q1/705C12Q1/6844C12Q2531/119C12Q2565/625Y02A50/30
Inventor 郝贵杰林锋沈锦玉盛鹏程潘晓艺
Owner ZHEJIANG INST OF FRESH WATER FISHERIES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap