Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant vector, preparation method thereof and method for improving turnip mosaic virus resistance and/or yield of vegetable crops

A technology of recombinant vectors and vegetables, applied in the biological field, can solve the problems of incomplete reference sequences and the inability to study the role of miR1885a in depth, and achieve the effect of strong resistance

Active Publication Date: 2020-03-17
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the incomplete reference sequence of the early rapeseed genome, it is impossible to study the role of miR1885a in the interaction between rapeseed and TuMV

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant vector, preparation method thereof and method for improving turnip mosaic virus resistance and/or yield of vegetable crops
  • Recombinant vector, preparation method thereof and method for improving turnip mosaic virus resistance and/or yield of vegetable crops
  • Recombinant vector, preparation method thereof and method for improving turnip mosaic virus resistance and/or yield of vegetable crops

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Embodiment 1 Construction of STTM-1885-1885 vector

[0040] (1) Use the pOT2-poly-cis vector as a template, and use the following primers to carry out PCR amplification under the catalysis of LongAmp Taq enzyme (purchased from NEB Company);

[0041] Upstream primer (5'→3'): gccATTTAAATatggtctaaagaagaagaat GGAATCATACC cta TTTCAT TGATG gaattcggtacgctgaaatcaccag (underlined is the reverse complementary sequence of bra-miR1885a) (SEQ ID NO.1)

[0042] Downstream primer (5'→3'): gccATTTAAATtagaccataacaacaacaac CATCAATGAAA tag GGTATG ATTCC aagcttgggctgtcctctccaaatg (the sequence of bra-miR1885a is underlined) (SEQ ID NO. 2).

[0043] PCR amplification program:

[0044] 94°C, 2 minutes;

[0045] [94°C, 30 seconds; 58°C, 30 seconds; 68°C, 4 minutes] 30 cycles;

[0046] 68°C, 10 minutes;

[0047] 4°C, 1 minute.

[0048] After the PCR product was recovered, it was digested with SwaI. After purifying and recovering the digested fragments with a DNA purification c...

Embodiment 2

[0057] The acquisition of embodiment 2 Brassica napus / STTM-1885-1885

[0058] Using Westar ecotype Brassica napus (B.napus cv.Westar) as the recipient plant, transfer the recombinant vector STTM-1885-1885 into Westar ecotype Brassica napus, and obtain Brassica napus expressing STTM-1885-1885 fragment / STTM-1885-1885.

[0059] The specific method is as follows:

[0060] (1) Transformation of Brassica napus

[0061] 1.1 Culture medium preparation

[0062] Murashige&Skoog (MS) medium powder (purchased from Duchefu company)

[0063] Medium 0 medium: 1 / 2MS (MS 2.2g), 30g sucrose, add double distilled water to about 950ml to adjust the pH to 5.8-6.0, add double distilled water to adjust the volume to 1000ml, add plant agar Phytagel (purchased from Sigma company) 3.5g, sterilized by high temperature steam at 113℃ for 20min.

[0064] Dilute medium: MS 4.4g, sucrose 30g, add double distilled water to 1000ml to adjust pH to 5.8, sterilize by high temperature steam at 113°C for 20mi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinant vector and a preparation method thereof, and a method for improving the turnip mosaic virus resistance and / or yield of vegetable crops. The recombinant vector provided by the invention comprises a complementary binding site of an RNA sequence as shown in SEQ ID NO.8. A transcribed RNA product of the recombinant vector mediates the degradation of miR1885a or inhibits the regulation and control of the miR1885a on a target by being combined with the miR1885a.

Description

technical field [0001] The present invention generally relates to the field of biotechnology, and specifically relates to a recombinant vector and a preparation method thereof, and a method for improving vegetable crop turnip mosaic virus resistance and / or yield. Background technique [0002] MicroRNA microRNA (miRNA) can regulate the mRNA expression level and translation of target genes, so it plays an important role in plant growth and development and stress resistance. In the process of disease resistance, miRNAs affect the interaction between plants and pathogenic microorganisms by targeting important genes in the process of disease resistance. [0003] The inventors found in early studies that the miRNA bra-miR1885a cloned from rapeseed can be specifically induced to express by Turnip Mosaic Virus (TuMV). TuMV is a member of the Potyviridae family and is one of the top five plant pathogenic viruses that cause the most serious damage to vegetable crops in the world. At...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82A01H5/00A01H6/20
CPCC12N15/8218C12N15/8283Y02A40/146
Inventor 郭惠珊汪晶晶崔辰房媛媛
Owner INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More