A method for selecting mstn gene molecular markers for growth traits of Chinese soft-shelled turtle
A growth trait and molecular marker technology, applied in the field of molecular biology, to improve the efficiency of seed selection, and the selection method is simple and effective.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0021] In order to better understand the present invention, the present invention will be further described below in conjunction with the examples, and the following examples are only to illustrate the present invention and not to limit it.
[0022] 1. Chinese soft-shelled turtle MSTN Gene DNA sequence PCR amplification and polymorphism detection
[0023] 1. Chinese soft-shelled turtle MSTN PCR amplification of gene DNA sequence
[0024] Chinese soft-shelled turtle downloaded from NCBI MSTN The full-length sequence of the gene (GenBank No: NW_005852453.1) designed specific amplification primers P1 and P2, using 30 Chinese soft-shelled turtle genome DNA as a template, in Taq Under the buffer environment of PCR master mix, the primers P1 and P2 were used to amplify under PCR conditions, and the product was purified and sequenced to obtain the target fragment with a length of 417 bp.
[0025] The primer sequences are as follows:
[0026] P1: TCTGTTTATATGATATGCTGGC (SEQ ID N...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com