A kind of molecular marker primer and method for differentiating long handle almond, Mongolian almond and elm leaf plum
A long-stalked almond and molecular marker technology, applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc., can solve problems such as complex structure and composition, low copy number of plant mtDNA, limited application range, etc. , to achieve the effects of improving detection speed and efficiency, fast and simple detection system, and simple identification method
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] 1. Collection of Leaf Samples
[0053] The samples were identified and collected by the Inner Mongolia Forest Tree Breeding Center, and 5 fresh, healthy, and pest-free leaf samples were collected from different origins of almonds, Mongolian almonds, and eucalyptus. As described in Table 1.
[0054] Table 1 Leaf samples and sources of almonds, Mongolian almonds and Yuyemei
[0055]
[0056] 2. Extraction of total genomic DNA from leaf samples
[0057] The total genomic DNA of the leaf sample was extracted by the plant DNA rapid extraction kit, and its quality was detected based on 1.2% agarose gel electrophoresis, and the results showed as follows: figure 1 As mentioned above, the brightness and uniformity of the electrophoresis strips and the light spots of the sample port are all good, indicating that the samples are of high purity and no pollution, and can be directly used in subsequent molecular biology experiments.
[0058] 3. PCR amplification for the target ...
Embodiment 2
[0074] Embodiment 2 result analysis
[0075] After the PCR product was purified, two-way sequencing was performed, and the sequences of the leaf sample group of Long handle almond, Mongolian almond leaf sample group and Yuyemei leaf sample group were compared. The result of the alignment of the trnK-UUU fragment sequence of the chloroplast gene with the sample group of Yuyemei leaves is as follows:
[0076] Almonds with long handles:
[0077] ACTCGAACCCGGAACTAGTCGGATGGAGTAGATAATTTCCTTGATTAGAAAATTTTAAATAAAATAGGGAAAAA(A) + CCCCTCCCCAAACCGTGCTTGCATTTTTCATTGCACACGGCTTTCCCTATGTATACATCTAAAATTCAGTCCCTTCCCTATACACGACTCTAAGAAAGTTGAATACTCAGTTGATCGACCCTCAATCTTACTGTATGAACATTTCATAATAGAAATAAATGCAAATTTTTT(ATAGAAATAAATGCAAATTTTTT) + GTTATCTCTTTCATTATTTAAAGA G AATTCCATTTCTACGATCGCATAACCAATTATTCATAATTGATTAGATCATTGATGCAAAAAATA T CCAAATACCAAATCCGACCTCTATAAAATTTCTTAAAAGTAAAAGTATAAGAAGCTCTTGGGAAGACCAA A GAAAGAATCTGTTCTTCTTCCGTAAAGAATTCTTCCAATAATTTAGAACCTAATCTTTTCAAAAAAGTTCGTACAGTACTTTTTGTGTTTAC...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com