Method for obtaining label-free transgenic plant
A transgenic plant, marker-free technology, applied in botany equipment and methods, biochemical equipment and methods, plant products, etc., can solve the problem of cumbersome operation of marker-free transgenic plants, and achieve the effect of simple operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment approach
[0029] According to a typical embodiment of the present invention, the gene editing protein gene is Cas9 gene or Cpf1 gene, and of course it can also be other protein genes capable of achieving similar gene editing.
[0030] Preferably, the vector also contains elements of the matching Cas9 gene or Cpf1 gene, which is convenient for subsequent operations. In a typical embodiment of the present invention, such as figure 2 As shown, the basic elements of the vector include hygromycin resistance element, gRNA element, MADS15-driven Cas9 system and GFP reporter gene.
[0031] According to a typical embodiment of the present invention, the vector is a binary expression vector, preferably Pcambia 1300.
[0032] According to a typical embodiment of the present invention, the plants used to obtain the marker-free transgenic plants include rice, wheat, potato, sweet potato, poplar and citrus.
[0033] The beneficial effects of the present invention will be further described below in...
Embodiment 1
[0035] 1. Vector Construction
[0036]Using pC1300-Cas9 as the vector, BamHI / NcoI was used for double enzyme digestion, and the vector was linearized. Using rice DNA as a template, primers
[0037] M15-P-F (SEQ ID NO: 2):
[0038] 5'-CGAGCTCGGTACCAAGGATCCGAAAAGCTTACGGGCCTCTTTGA-3'
[0039] M15-P-R (SEQ ID NO: 3):
[0040] 5'-TCTTCTTCTTAGGGGCCATGGTCTCTATCCGCTTCAGCTGCACC-3'
[0041] The 3614bp sequence of the promoter region of LOC_Os07g01820 gene was amplified, and pC1300-MADS15P-Cas9 was constructed by Gibson connection.
[0042] PmeI digestion pC1300-MADS15P-Cas9 vector, primers
[0043] cas-Hgfp-F (SEQ ID NO: 4):
[0044] CGTTTCCCGCCTTCAGTTTAAACTGCCACCTGACGTGAGCTCGGTA
[0045] cas-Hgfp-R (SEQ ID NO: 5):
[0046] TGTCAAACACTGATAGTTTAAACCGGTGTGAGGGAACTAGTTTTGAT
[0047] The 2X35S-driven GFP element sequence was amplified and T4 ligated to construct the pC1300-MADS15P-Cas9-GFP vector. According to the requirements of the CRISPR-Cas9 system for the target sequence (PAM...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com