A kind of small molecule inhibitor and its application
A technology of small molecule inhibitors and inhibitors, applied in anti-infective drugs, drug combinations, anti-tumor drugs, etc., can solve problems such as weak binding ability, large toxic side effects, and high concentration of action
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] The small molecule inhibitor involved is: 4-(2,3-Dihydro-1H-perimidin-2-yl)-benzonitrole, the structural formula is as follows:
[0042]
[0043] The activity detection method is as follows:
[0044] 1. Construction of human ODC prokaryotic expression plasmid
[0045] The gene sequence of human ODC was inserted into the pET28a plasmid through BamH I and Xho I restriction sites to construct the pET28a-hODC plasmid, which was verified by DNA sequencing.
[0046] Gene sequence of human ODC:
[0047] atgaacaactttggtaatgaagagtttgactgccacttcctcgatgaaggttttactgccaaggacattctggaccagaaaattaatgaagtttcttcttctgatgataaggatgccttctatgtggcagacctgggagacattctaaagaaacatctgaggtggttaaaagctctccctcgtgtcacccccttttatgcagtcaaatgtaatgatagcaaagccatcgtgaagacccttgctgctaccgggacaggatttgactgtgctagcaagactgaaatacagttggtgcagagtctgggggtgcctccagagaggattatctatgcaaatccttgtaaacaagtatctcaaattaagtatgctgctaataatggagtccagatgatgacttttgatagtgaagttgagttgatgaaagttgccagagcacatcccaaagcaaagttggttttgcggattgccactgatgatt...
Embodiment 2
[0064] The small molecule inhibitors involved are: 2,3-Dihydro-1H-perimidine-2-carbonitrile,
[0065] The structural formula is shown in the figure:
[0066]
Embodiment 3
[0068] The small molecule inhibitors involved are:
[0069] 4-[(2,3-Dihydro-1H-perimidin-2-ylimino)-methyl]-benzonitrole,
[0070] The structural formula is shown in the figure:
[0071]
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com