Plant peduncle development related protein, and coding gene and application thereof
A technology for encoding genes and proteins, applied in plant genetic improvement, angiosperms/flowering plants, applications, etc., can solve problems such as inability to explain flower stalks
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Embodiment 1, the acquisition of the sped1-D gene related to rice panicle shape
[0039] 1. Traits of sped1-D mutant
[0040] Under the natural conditions in summer, the vegetative growth state of the sped1-D mutant is normal, but the panicle morphology changes, mainly in two aspects: one is that from the point of view of the growth state of the spikelet, it was originally distributed in a cascade on the first and second branches The grains (spikelets) on the top part are clustered together, usually 3 to 5 grains are clustered, and the spikelets on the first and second branches are still shaved according to the 3 to 5 grains below the top. The distance grows on the branches; secondly, from the perspective of the characteristics of the terminal branches, all the peduncles directly connected to the spikelets are extremely shortened to about 1.0 mm, and each level of peduncle has 1 to 3 nodes shortened from top to bottom. Among them, 1 shortened peduncle shows clusters of...
Embodiment 2
[0057] Embodiment 2, the spike shape analysis of transgenic rice plant of sped1-D
[0058] Design primers according to the sped1-D gene amplified in the above-mentioned embodiment 1, add EcoRI and HindIII restriction sites, and the primer sequences are as follows:
[0059] sped1-D-F: GC GAATTC GGCTGACCTCAGCTTGAGTT (the underline is the EcoRI site) (sequence 3 in the sequence listing),
[0060] sped1-D-R: GC AAGCTT GTTGGTCCAGTCAAACTAATG (the underline is the HindIII site) (sequence 4 in the sequence listing),
[0061] Using the sped1-D gene shown in Sequence 2 in the artificially synthesized sequence listing as a template, perform PCR amplification to obtain a full-length double-stranded cDNA product of 1176bp sped1-D gene, and add EcoRI at both ends of the gene sequence and HindIII restriction sites. After the product was double-digested with EcoRI and HindIII, it was connected between the EcoRI and HindIII restriction sites of the expression vector pCAMBIA1301 (purchase...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com