Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

PCR (polymerase chain reaction) method for detecting Hokovirus for pigs

A hokovirus, downstream technology, applied in the field of animal virology and zoonosis, can solve the problem of disease

Inactive Publication Date: 2013-01-30
JIANGSU ACAD OF AGRI SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, it is speculated that porcine Hokovirus virus may infect most of the tissues of pigs, and since there is no difference in the infection rate of porcine Hokovirus in healthy pigs and diseased pigs, whether the virus can cause disease needs further research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCR (polymerase chain reaction) method for detecting Hokovirus for pigs
  • PCR (polymerase chain reaction) method for detecting Hokovirus for pigs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Pig serum and liver collected clinically (Xieqiao Pig Farm, Changshu City, Suzhou City, Jiangsu Province) were tested for pig Hokovirus. The specific steps are as follows:

[0029] (1) Extraction of DNA: Take 472.5 μl of serum; take 100 mg of liver, add 1 ml of PBS buffer for thorough grinding, freeze and thaw three times at -20°C, centrifuge at 8000 rpm for 10 minutes, and take 472.5 μl of supernatant, Add 25 μl of 10% SDS, 2.5 μl of 20 mg / ml proteinase K, mix well and place it at 37°C for overnight digestion or 50°C water bath for 4 hours, add an equal amount of phenol:chloroform:isoamyl alcohol (25:24:1) to pump Extract twice, take the supernatant, add 2 times the volume of pre-cooled absolute ethanol at -20°C for 1 hour, and centrifuge at 12,000 rpm for 10 minutes. The supernatant was discarded, and the precipitate was dried in a drying oven and dissolved in 20 μl of ultrapure water, which was the DNA template for detection. The extracted DNA templates were stored at...

Embodiment 2

[0034] According to the method of Example 1, the porcine Hokovirus positive disease material is used as a positive control, respectively for porcine reproductive and respiratory syndrome virus, porcine circovirus type 2, swine fever virus, pseudorabies virus, porcine boca virus, porcine transfusion transmitted virus , Japanese encephalitis virus, and porcine Cnvirus were detected, but no bands were amplified, and porcine Hokovirus positive samples amplified a band of about 540 bp in size, see figure 1 . 其序列为SEQ ID NO. 3:GTTGGTCCTGGTAATCCTTTGGATAATGCTCCCGCTAAGGGACCAGTGGATGAAGCAGCGAAACACCACGATGAACGGTACGATGAAATGCTTCGCCATGGTGATTTGCCATACATCCATGGGAGAGGGGCTGATAGGTTGATGAATAAGGAGATAGAGAGGGCGGAGCAGGAGGGTAAAATTGATAACCCTGTGGATGCATTGGTGGGTAATGCAATCCGGGGTATCTGGGAGGCAAAGGAGACTCTTGGGGATATTGCAGATGTTCAATTATCACAGGTTTTACCGCCCGACCCGCCTACCAGCCAAGTGCTTCCGGGCTCTTCAGAAGACGCCCCCAGCCCGAAGAGACAGAGGGCTGGTACCCCTGATTCTGTTCCTACGCCTGGCAACCCATCCCCTGCGCCAATTGCTGATCCTGCTACAATCATGGCTGCGCCGGTAACGGGCGCCACCGGTGGGGGTA...

Embodiment 3

[0036] Example 3: sensitivity test

[0037] The standard positive plasmid containing VP1 / 2 gene (10 11 copies) Use the configured TE (PH8.0) 10-fold incremental dilution as a template, take 2 μl of each dilution as a template, and perform detection according to the method in Example 1, observe positive bands, and use the template used for positive expected bands The highest dilution of the amount was used to calculate its sensitivity, and the results showed that the minimum detection amount was 10 4 copies, see figure 2 .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a PCR (polymerase chain reaction) method for detecting Hokovirus for pigs, belonging to the field of biotechnology. The PCR method comprises the steps of: adopting a PCR system of 25 microliter, respectively adding buffer solution, upstream primers, downstream primers, DNA polymerase and extracted DNA formworks into PCR reaction tubes of 0.2ml, adding sterilized ultrapure water until the total volume is reached; evenly mixing the reagent, then pouring the reagent in a PCR amplifier, and conducting denaturation, annealing and extending for total 35-time circulation; after the reaction of the PCR is finished, taking 10mul product on agarose gel, carrying out electrophoresis by using TAE (Tris-acetate-ethylene diamine tetraacetic acid) buffer solution, observing a PCR product under an ultrasonic projection instrument, and contrasting with standard molecular weight, wherein a positive sample has 540bp segments. The detection method provided by the invention has the advantages of high sensitivity, good specificity, simplicity and convenient and fastness in operation, has low requirement for the quality of detected materials, and facilitates clinical application.

Description

technical field [0001] The invention belongs to the technical field of animal virology and animal infectious disease. In particular, it relates to a PCR method for detecting pig Hokovirus. Background technique [0002] Porcine Hokovirus (PHoV) is a porcine parvovirus newly discovered in Hong Kong in 2008 (Lau et al. Identification of novel porcine and bovine parvoviruses closely related to human parvovirus 4. J. Gen. Virol. 2008, 89: 1840-1848). It belongs to the same subtype of Hokovirus as bovine Hokovirus, and both belong to the genus Parvovirus ( Parvovirinae ). Porcine Hokovirus is very closely related to human parvovirus types 4 and 5 (PARV4 / 5). [0003] Porcine parvovirus can cause reproductive disorders in pigs, characterized by abortion, stillbirth, and mummification in pregnant sows. Domestic and wild boars of all ages and sexes are susceptible. The source of infection mainly comes from parvovirus-infected sows and virus-infected boars. Gilts are more suscepti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
Inventor 李彬何孔旺毛立温立斌张雪寒倪艳秀郭容利周俊明茅爱华王小敏
Owner JIANGSU ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com