Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A method of inhibiting fibroblast differentiation of MSCs, MSCs and DNA fragments

A technology of fibrogenesis and fragmentation, applied in the direction of DNA/RNA fragmentation, recombinant DNA technology, biochemical equipment and methods, etc., can solve problems such as limiting the application of MSCs, and achieve the effect of reducing the risk of differentiation into fibroblasts

Active Publication Date: 2019-05-10
JIANGSU PROVINCIAL CENT FOR DISEASE PREVENTION & CONTROL
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] Therefore, the risk of MSCs differentiation into fibroblasts greatly limits the application of MSCs in clinical therapy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method of inhibiting fibroblast differentiation of MSCs, MSCs and DNA fragments
  • A method of inhibiting fibroblast differentiation of MSCs, MSCs and DNA fragments
  • A method of inhibiting fibroblast differentiation of MSCs, MSCs and DNA fragments

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Primary culture of embodiment 1 mouse MSCs

[0051] Culture mouse bone marrow MSCs in the following manner:

[0052] (1) Choose about 30-40g C57BL / 6 female mouse, separate the femur and tibia of the mouse under sterile conditions, remove the muscle tissue and connective tissue, wash the bone marrow cavity with PBS, blow the bone marrow, and obtain the bone marrow cell suspension , and then filter the cells through a 100-mesh sieve to remove bone fragments and other impurities.

[0053] (2) Collect the cell suspension, centrifuge at 1500rpm / min for 5 minutes, discard the supernatant, resuspend the cells with a 1:4 mixture of PBS and ACK erythrocyte lysate, centrifuge at 1500rpm / min for 15 minutes, discard supernatant. Wash 3 times with PBS.

[0054] (3) Resuspend the cells with 10% FBS-containing DMEM basal medium (adding 1% L-glutamine, 1% penicillin and streptomycin) and add 1×10 6 Inoculate cells / ml in a 100mm cell culture dish at 37°C, 5% CO 2 In a cell incubato...

Embodiment 2

[0057] Example 2 Preparation of Axin1-RNAi lentiviral vector

[0058] Prepare the Axin1-RNAi lentiviral vector as follows:

[0059] (1) After multiple screenings, it was finally determined that two single-stranded DNA oligonucleotides were synthesized to inhibit the expression of the Axin1 gene, and their nucleotide sequences were as follows:

[0060] Sense strand (5'-3'): TCCCACTTTGAATGAGGATGAACTCGAGTTCATCCTCATTCAAAGTGGGTTTTTTTC (SEQ ID NO: 1);

[0061] Antisense strand (5'-3'): TCGAGAAAAAAA CCCACTTTGAATGAGGATGAACTCGAGTTCATCCTCATTCAAAGTGGGA (SEQ ID NO: 2).

[0062] (2) The single-stranded DNA oligonucleotides are paired to generate double strands by annealing, and the two ends of the formed double strands contain sticky ends with enzyme cutting sites, which are directly connected to the RNAi lentiviral vector pGC-LV after enzyme digestion .

[0063] (3) Transfer the ligation product into the prepared DH5α bacterial competent cells, and after the positive recombinants were ...

Embodiment 3A

[0065] Example 3 Titer detection of Axin1-RNAi lentiviral vector

[0066] Package and detect the titer of Axin1-RNAi lentiviral vector as follows:

[0067] (1) Preparation of high-quality viral vectors: Prepare recombinant viral plasmids encoding lentiviral particles and their two auxiliary packaging original pHelper plasmids, and perform high-purity and endotoxin-free extractions on the three plasmid vectors.

[0068] (2) Co-transfection of 293T cells: Co-transfection of 293T cells was carried out according to the instructions of Lipofectamine 2000 from Invitrogen Company. After 8 hours of transfection, the medium was replaced with complete medium.

[0069] (3) Virus harvesting and concentration: after culturing for 48 hours, the cell supernatant rich in lentivirus particles was collected and concentrated to obtain a high-titer lentivirus concentrate.

[0070] (4) Use TCID50 (Tissue Culture Infection Dose 50) method to measure virus titer: ① Inoculate 293T cells in logarithm...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for inhibiting fibroblast differentiation of MSCs, the MSCs and a DNA segment. By inhibiting the expression of an Axin1 gene, the expression of Wnt / beta-Catenin signal pathway proteins including beta-Catenin, GSK-3beta and JNK can be inhibited, and the expression of a fibroblast surface molecule mark Vimentin and alpha-SMA can be inhibited, so that the MSCs with inhibited fibroblast differentiation capacity are obtained, and the side effect of the MSCs differentiated into fibroblasts in clinic treatment is reduced.

Description

technical field [0001] The invention relates to the field of stem cells, in particular to a method for inhibiting MSCs fibroblast differentiation, MSCs and DNA fragments. Background technique [0002] Mesenchymal stem cells (mesenchymal stem cells, MSCs), derived from the mesoderm in early development, belong to multipotential adult stem cells, and are important members of the stem cell family; they were first discovered in the bone marrow and widely distributed in the human body, such as In bone marrow, umbilical cord, fat, umbilical cord blood, amniotic membrane, (placental) chorion, dental pulp, thymus, synovium, fetal blood and liver. [0003] MSCs have the general biological characteristics of stem cells: they have self-replication ability and multiple differentiation potentials; they are non-terminal differentiated cells, maintain undifferentiated or poorly differentiated characteristics throughout their lives, and lack differentiation markers; their differentiation is...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/867C12N5/10C12N15/113
CPCC12N5/0663C12N15/113C12N15/86C12N2310/14C12N2740/15043
Inventor 李燕朱凤才姚乐申陆伟竺丽梅彭海燕宋红焕李国莉温恬迟莹邵燕陈诚
Owner JIANGSU PROVINCIAL CENT FOR DISEASE PREVENTION & CONTROL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com