Primers and method for purity identification of cucurbita maxima 'Danhong No.3' hybrid seeds

A hybrid seed purity, Indian pumpkin technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve the problem of the unestablished Indian pumpkin 'Danhong No. 3' hybrid seed purity identification method, etc. problem, to achieve the effect of high commercial application value, low cost and simple operation

Pending Publication Date: 2017-03-22
INST OF VEGETABLES GUANGDONG PROV ACAD OF AGRI SCI
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no method for identifying the puri...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers and method for purity identification of cucurbita maxima 'Danhong No.3' hybrid seeds
  • Primers and method for purity identification of cucurbita maxima 'Danhong No.3' hybrid seeds
  • Primers and method for purity identification of cucurbita maxima 'Danhong No.3' hybrid seeds

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Establishment of a method for detecting the purity of hybrid pumpkin 'Danhong 3' seeds

[0031] 1. Screen the SSR primers for purity identification.

[0032] The pumpkin EST-SSR primers were screened among the parents (the male parent Hongpi No. 6 and the female parent Pink No. 1), and the primers S18 and S40 of the co-dominant differential marker band were selected. The sequences are as follows:

[0033] S18F: AGGGAGCTGGAACACCAAG (SEQ ID NO: 1),

[0034] S18R: CCAATACCCTACGCCTTCAC (SEQ ID NO: 2),

[0035] S40F: CGATATGATGGAGCTGCTGA (SEQ ID NO: 3),

[0036] S40R: CCAGCTCCCGAGCTTCTAAT (SEQ ID NO: 4).

[0037] The marking band is clear and repeatable. Primer S18 produces a 142bp maternal-specific marker and a 134bp paternal-specific marker; primer S40 produces a 170bp paternal-specific marker and a 190bp maternal-specific marker.

[0038] 2. Using the above-mentioned specific primers to identify the purity of hybrid pumpkin 'Danhong 3' seeds.

[0039] (1) ...

Embodiment 2

[0064] Adopt the method of embodiment 1 to utilize primer S40 to 48 strains ' Danhong No. 3 ' that get from the seed purity identification field of Baiyun Base, number its single plant, extract single plant DNA and detect (see figure 2 ), the test result is that No. 7 is a false hybrid, and the seed purity is 98%, which is consistent with the field investigation results, and the accuracy rate is 100%.

Embodiment 3

[0066] Using the method of Example 1, primer S18 was used to detect the above-mentioned seeds. No. 7 was a false hybrid, and the rest were true hybrids. The purity of the seeds was 98%, which was consistent with the detection result of primer S40.

[0067] The above examples show that the method of the present invention can effectively distinguish the 'Danhong No. 3' hybrid seed from its female parent (Zaoxuan No. 1) seed, and quickly and accurately detect the purity of the seed; and the two primers S40 and S18 The detection results were consistent, and the accuracy rate was 100%.

[0068] The above method of the present invention can distinguish the hybrid seeds of 'Danhong 3' from its female parent and male parent seeds, quickly detect the purity of the hybrid seeds, and has the advantages of fast, accurate, low cost, and simple operation.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses primers and a method for purity identification of cucurbita maxima 'Danhong No.3' hybrid seeds. The primer group is either a primer group S18 or a primer group S50; the primer group S18 can achieve PCR amplification of a 142bp female parent specific marker and a 134bp male parent specific marker in a 'Danhong No.3' hybrid seed genome; and the primer group S40 can achieve PCR amplification of a 170bp female parent specific marker and a 190bp male parent specific marker in the 'Danhong No.3' hybrid seed genome. According to the method provided by the invention, the 'Danhong No.3' hybrid seed can be separated from female and male parent seeds thereof, and the purity of the hybrid seeds can be detected rapidly; the method has the advantages of being rapid, accurate, low in cost, simple to operate and the like; the method can replace a conventional hybrid seed purity identification method; and the method is relatively high in commercial application value.

Description

technical field [0001] The invention belongs to the field of molecular detection, and in particular relates to a primer and a method for identifying the purity of Indian pumpkin 'Danhong No. 3' hybrid seeds. Background technique [0002] Seed purity is one of the most important quality indicators for seed quality inspection. The test of Distinctness, Uniformity and Stability of new plant varieties (DUS test for short) is the most important work content in the substantive examination of the new variety rights granted by the Office of Plant Variety Protection of the Ministry of Agriculture. . [0003] "Danhong 3" is a first-generation hybrid pumpkin variety. When producing seeds, the female parent and the male parent are planted in different plots, and all male flower buds on the female parent are removed before the female flower blooms. During the flowering period, pollen from the male parent is used to pollen the stigma of the female parent to produce hybrid seeds. If th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895C12Q1/686C12Q2565/125
Inventor 王瑞吴廷全黄河勋钟玉娟金庆敏黄智文罗少波
Owner INST OF VEGETABLES GUANGDONG PROV ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap