Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cloning of Japanese blood fluke vaccine antigen gene and its expression and application

A schistosomiasis prevention and vaccine technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of high cost, no public reports of new schistosomiasis vaccine, tissue damage without repairing effect, etc.

Active Publication Date: 2009-06-10
STATION OF VIRUS PREVENTION & CONTROL CHINA DISEASES PREVENTION & CONTROL CENT +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Years of practice have proved that repeated chemotherapy can temporarily reduce the incidence in epidemic areas, but it is difficult to stop the spread
At the same time, chemotherapy also has the following disadvantages: 1) chemotherapy has no repair effect on the tissue damage that has been caused; 2) patients and sick animals can be repeatedly infected after chemotherapy, and repeated chemotherapy and long-term testing are required, which requires expensive expenses and specialized personnel; 3) Some strains have been found to be resistant to the chemotherapy drug praziquantel
Previous studies have shown that P50 can be recognized by soluble extracts of Schistosoma mansoni and epidermal extracts, indicating that Smp50 may exist in the epidermis, and anti-P50 antiserum cannot recognize extracts of Hela cells and Escherichia coli, indicating the source Although there are many similarities in the general structure of FKBP from different species, the differences in the overall structure and sequence are enough to produce different antibody responses
[0012] Prior to the present invention, there have been no published reports relating to the new Schistosoma japonicum vaccine of the present invention

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cloning of Japanese blood fluke vaccine antigen gene and its expression and application
  • Cloning of Japanese blood fluke vaccine antigen gene and its expression and application
  • Cloning of Japanese blood fluke vaccine antigen gene and its expression and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Acquisition of Schistosoma japonicum antigen SjE16 and antigen SjP50 genes.

[0042] 1. Design and synthesis of primers

[0043] According to the sequence of Sj50 gene and Sj16 gene, primers were analyzed and designed by Primerexpress software, and two pairs of primers were synthesized by Shanghai Shenyou Bioengineering Company.

[0044] Sj50-F is 5'CCGGAATTCATGTCGGAGACGCCAAAGC3' (SEQ ID NO: 5), and the EcoR I restriction site GAATTC is introduced;

[0045] Sj50-R is 5'CCGCTCGAGCAGAATTAAGCTCTCACAGGGCA3' (SEQ ID NO: 6); the Xho I restriction site CTCGAG is introduced;

[0046] Primer Sj16-F is 5'CCGGAATTCCTTCATCTCAGAATAATGTCGGA3' (SEQ ID NO: 7), which introduces EcoR I restriction site GAATTC;

[0047] Sj16-R is 5'CCGCTCGAGCATACGTTTGACGTACATAAGCT3' (SEQ ID NO: 8), which introduces the Xho I restriction site CTCGAG.

[0048] The stock concentration of primers is 50mM, and the working concentration is 10mM.

[0049] 2. PCR amplification of Sj50 gene and Sj16 gene

[0...

Embodiment 2

[0054] Cloning and expression of Schistosoma japonicum antigen SjE16 and antigen SjP50 genes.

[0055] 1. Construction of expression vector

[0056] The recovered and purified Sj50 gene, Sj16 gene and plasmid pGEX4T-1 were digested with restriction endonucleases EcoR I and Xho I, respectively. 10 μl template plus EcoR I 1 μl, Xho I 1 μl, EcoR I buffer 1.5 μl, BSA 0.5 μl and deionized water 1 μl, a total of 15 μl was placed in a 1.5ml Eppendorf tube in a 37°C water bath overnight.

[0057] The digested Sj50 gene, Sj16 gene and plasmid pGEX4T-1 were recovered and purified with QIAquick PCR Purification kit. The purified target gene fragment and vector fragment were digested, the OD value was measured, and the concentration of the fragment and carrier fragment was calculated. The target fragment and carrier fragment were connected at a molar ratio of 3:1. The ligation system contains 1 μl of T4 DNA ligase, 1 μl of 10× ligation buffer, deionized water, pGEX4T-1 (80ng), Sj50 gene...

Embodiment 3

[0071] RT-PCR identification of the transcriptional expression of SjE16 and SjP50 in each developmental stage of Schistosoma japonicum.

[0072] 1. Sample Preparation

[0073] The eggs, cercariae, males, and females of Schistosoma japonicum were prepared to extract their RNA.

[0074] 2. Total RNA extraction kit

[0075] The RNA extraction reagent uses TRIzol reagent (GIBCO / BRL), which is produced based on the one-step extraction method with acidic phenol. The utensils and water used for RNA extraction must be RNase-free to ensure an RNase-free environment in the experiment.

[0076] 3. RNA extraction steps

[0077] Dry-bake the pestle, homogenizer and other utensils at 200°C for 4 hours to remove RNase and cool down; add liquid nitrogen to pre-cool, take the tissue out of the liquid nitrogen quickly, and grind it into powder; use a spatula to put the tissue into the pre- Add TRIzol reagent to the homogenizer and homogenize for several minutes; transfer the homogenized liq...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
electrical resistanceaaaaaaaaaa
Login to View More

Abstract

The invention discloses the Schistosoma japonicum antigen gene SjE16 and SjP50, its coding protein and method for recombinating, expressing and separating the protein. The invention also discloses the prevention and cure vaccine of schistosomiasis prepared from antigen SjE16 antigen SjP50 protein. The Schistosoma japonicum antigen SjE16 and antigen SjP50 coding protein and its vaccine have a broad prospect in the prevention and treatment of schistosomiasis.

Description

technical field [0001] The invention relates to the field of biological genes, in particular to the nucleic acid sequences of Schistosoma japonicum antigen genes SjE16 and SjP50 and their encoded proteins; in addition, the invention also relates to the application of the Schistosoma japonicum antigen SjE16 and SjP50 proteins as vaccines. Background technique [0002] At present, the main control strategies are large-scale chemotherapy, mollusc control and health education in susceptible areas. Years of practice have proved that repeated chemotherapy can temporarily reduce the incidence in epidemic areas, but it is difficult to stop the transmission. At the same time, chemotherapy also has the following disadvantages: 1) chemotherapy has no repair effect on the tissue damage that has been caused; 2) patients and sick animals can be repeatedly infected after chemotherapy, and repeated chemotherapy and long-term testing are required, requiring expensive expenses and specialized...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/13C12N15/30C07K14/435C07K16/18C12N15/63C12N15/09C12P21/02A61K39/002A61P33/12
CPCY02A50/30
Inventor 胡薇冯正王志勤韩泽广王兆军徐斌王升跃
Owner STATION OF VIRUS PREVENTION & CONTROL CHINA DISEASES PREVENTION & CONTROL CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com